circad | circRNAs associated with diseases

circRNA9652
Gene	PDE3A	Organism	Human
Genome Locus	chr12:20621296-20654205:+	Build	hg19
Disease	Esophageal Squamous Cell Carcinoma (ESCC)	ICD-10	Oesophagus, unspecified (C15.9)
DBLink	Link to database	PMID	29218114
Experimental Method
Sample Type	Cell Lines	Comparison	SHEE and SHEEC cell lines.
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGCGATGAGTCAGGAGATA Reverse TCTGCTTTTGGTGAGGGT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Sun, J, Yuan, X, Li, X, Wang, D, Shan, T, Wang, W, Wan, Q, Wang, X, Yan, J, Gao, S (2017). Comparative transcriptome analysis of the global circular RNAs expression profiles between SHEE and SHEEC cell lines. Am J Transl Res, 9, 11:5169-5179.